All Collections
Library prep
What are the 16S sequencing primers?
What are the 16S sequencing primers?
Updated over a week ago

16S Barcoding Kit (SQK-RAB204 and SQK-16S024)

The 3' flanking sequence of the forward primer contains a wobble base (denoted by M; in the primer the base is either an A or a C) in a variable region of the 16S gene.

Forward 16S primer:

5' - ATCGCCTACCGTGAC - barcode - AGAGTTTGATCMTGGCTCAG - 3'

Reverse 16S primer:

5' - ATCGCCTACCGTGAC - barcode - CGGTTACCTTGTTACGACTT - 3'

Did this answer your question?